Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

106 – 120 of 920 results

106

MilliporeSigma™ Upstate™ JMJD6, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q6NYC1
Includes	This ChIPAb+ JMJD6 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	JMJD6
Regulatory Status	RUO
Gene Symbols	JMJD6, PTDSR1, PTDSR, PSR
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_001074930
Formulation	Anti-JMJD6 (rabbit polyclonal). One vial containing 50μL of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl and 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, human β-globin. One vial containing 75μL of each primer (5μM) specific for the human β-globin promoter. FOR: AGG ACA GGT ACG GCT GTC ATC; REV: TTT ATG CCC AGC CCT GGC TC
Immunogen	Linear peptide corresponding to human JMJD6.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes JMJD6.

107

MilliporeSigma™ Upstate™ Histone H3.3, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Western Blot
Gene Accession No.	P84243
Includes	This ChIPAb+ Histone H3.3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Histone H3.3
Regulatory Status	RUO
Gene Symbols	H3F3A, H3.3A, H3F3, PP781, H3F3B, H3.3B
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_002098
Formulation	Anti-Histone H3.3 (rabbit polyclonal). One vial containing 50μg of purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl with 0.05% sodium azide before the addition of glycerol to 30%. Concentration: 0.7mg/mL. Normal Rabbit IgG. One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. Control Primers, GAPDH Coding Region D2 Human. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GCC ATG TAG ACC CCT TGA AGA G; REV: ACT GGT TGA GCA CAG GGT ACT TTA T
Immunogen	KLH-conjugated linear peptide corresponding to human Histone H3.3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes human Histone H3.

108

MilliporeSigma™ Upstate™ CHD1, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	O14646
Includes	This ChIPAb+ Validated Antibody and Primer Set conveniently includes the antibody, matched IgG negative control antibody and set control PCR primers that detect a known positive locus.
Antigen	CHD1
Regulatory Status	RUO
Gene Symbols	Chd1, Chd-1
Gene ID (Entrez)	NP_001261
Formulation	Anti-CHD1 (Rabbit Polyclonal). One vial containing 7.0μg purified rabbit polyclonal in 50μL buffer of Tris-buffered Saline containing 0.1% BSA and 0.09% Sodium Azide, before the addition of 30% glycerol (0.14mg/mL final). Normal Rabbit IgG. One vial containing 125μg of purified Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSMC6. One vial containing 75μL of 5μM of each primer specific for human proteasome 26S subunit 6 (chr14:53174161+53174274 , hg19 build). Primer location selection based on ENCODE browser data at UCSC, see also reference 1. FOR: TCC GGC CCT GAG CTT GT; REV: CCT CCT CTA CTT CTT TTT CAT TTT CAC
Immunogen	Recombinant protein corresponding to human CHD1 (a.a. 1660-1710).
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes CHD1 in regions between a.a. 1660 to 1710.

109

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

110

MilliporeSigma™ RIPAb+™ Upf1 RIP Validated Antibody and Primer Set

This RIPAb+ Upf1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

111

MilliporeSigma™ RIPAb+™ hnRNP U RIP Validated Antibody and Primer Set

This RIPAb+ hnRNP U -RIP Validated Antibody and Primer Set conveniently includes the hnRNP U antibody and the specific control PCR primers.

Pricing & Availability

112

MilliporeSigma™ RIPAb+™ PABPC1 RIP Validated Antibody and Primer Set

This RIPAb+ PABPC1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

113

MilliporeSigma™ Ca_V2.2 (851-867), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Includes	50μL antibody lyophilized from PBS, 5% sucrose, 1% BSA, pH. 7.4 and 40μg control peptide lyophilized from PBS.
Antigen	Ca_V2.2 (851-867)
Regulatory Status	RUO
Content And Storage	−20°C
Host Species	Rabbit
Applications	Immunocytochemistry,Immunohistochemistry,Immunoprecipitation
Form	Purified
Formulation	50μl antibody lyophilized from PBS, 5% sucrose, 1% BSA, pH. 7.4 and 40μg control peptide lyophilized from PBS.
Immunogen	a synthetic peptide [(C)RHHRHRDRDKTSASTPA] corresponding to amino acids 851-867 of the α_1B-subunit of rat brain voltage-gated calcium channels,conjugated to KLH
Classification	Polyclonal
Isotype	IgG
Primary or Secondary	Primary
Test Specificity	Recognizes the ∽210kDa and the ∽240kDa forms of α_1B-subunit of Ca_v2.2. Supplied with a control peptide.

114

MilliporeSigma™ P2X7 Receptor (576-595), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Includes	50μL antibody lyophilized from PBS, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Antigen	P2X7 Receptor (576-595)
Regulatory Status	RUO
Content And Storage	−20°C
Host Species	Rabbit
Applications	Immunoblot,Immunoblot
Form	Purified
Formulation	50μl antibody lyophilized from PBS, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Immunogen	a synthetic peptide [(C)KIRKEFPKTQGQYSGFKYPY] corresponding to amino acids 576-595 of rat P2X7 receptor,conjugated to receptor protein
Classification	Polyclonal
Isotype	IgG
Primary or Secondary	Primary
Test Specificity	Recognizes the P2X7 receptor protein. Supplied with a control peptide.

115

Novus Biologicals™ Chemotherapy Insensitive Tumor Cells Antibody Pack

For Research applications

Pricing & Availability

116

Novus Biologicals™ Lymphoma Markers Antibody Pack

For Research applications

Pricing & Availability
Specifications

Antigen	Lymphoma Markers
Content And Storage	Aliquot and store at -20C or -80C. Avoid freeze-thaw cycles.
Target Species	Human,Rat
Conjugate	Unconjugated
Applications	Western Blot
Immunogen	See individual datasheets.

117

Novus Biologicals™ Postmenopausal Obesity and Metabolism Antibody Pack

For Research applications

Pricing & Availability

118

MilliporeSigma™ Ca_V1.2 (818-835), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Includes	50μL antibody in PBS, 5% sucrose, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Antigen	Ca_V1.2 (818-835)
Regulatory Status	RUO
Content And Storage	−20°C
Host Species	Rabbit
Applications	Immunocytochemistry,Immunohistochemistry,Immunoprecipitation
Form	Purified
Formulation	50μl antibody in PBS, 5% sucrose, 1% BSA, pH 7.4 and 40μg lyophilized control peptide (immunogen).
Immunogen	a synthetic peptide [(C)TTKINMDDLQPSENEDKS] corresponding to amino acids 848-865 of α_1C-subunit of rat brain voltage-gated calcium channels,conjugated to KLH
Classification	Polyclonal
Isotype	IgG
Primary or Secondary	Primary
Test Specificity	Recognizes the ∽190kDa and ∽210 forms of the α_1C-subunit. Supplied with a control peptide. Note: The α-subunit is highly sensitive to proteases. Please refer to the data sheet for proper sample preparation.